Interakcije monoklonskega protitelesa iMab z nukleotidnimi zaporedji DNA, bogatimi s citozini

Valte, David (author), Plavec, Janez (mentor)

I-motivi so nekanonične strukture DNA, ki nastajajo v nukleotidnih zaporedjih, bogatih s citozini. Tvorijo se v kislih pogojih, kjer protonirani citozinski ostanki tvorijo hemiprotonirane C•C⁺ bazne pare. Zaradi svoje dinamičnosti in reverzibilne narave igrajo pomembno vlogo pri regulaciji celičnih procesov transkripcije, podvajanja DNA in epigenetskih modifikacijah. Imunoprecipitacijske študije na podlagi vezave monoklonskih protiteles na jedrno DNA kažejo, da se i-motivi lahko tvorijo in vivo. Najpogosteje uporabljeno protitelo pri takšnih raziskavah je iMab, ki je bil razvit proti i-motivu, katerega tvori telomerno zaporedje hTeloC (CCCTAACCCTAACCCTAACCCT). iMab je enoverižni fragment človeškega monoklonskega protitelesa, ki se veže na inter- in intramolekularne i-motive. Hkrati iMab ne interagira s strukturami DNA kot so G-kvadrupleksi, dvoverižna DNA, lasnične zanke in z mutiranimi telomernimi zaporedji, ki ne tvorijo i-motivov. V zadnjem času so se pojavili dvomi glede specifičnosti iMab protitelesa za i-motive v primerjavi z nezvitimi s citozini bogatimi DNA zaporedji. Zato smo s spektroskopskimi metodami vključno z NMR, CD in DLS spektroskopijo karakterizirali funkcionalno stanje proteina iMab ter interakcijo med proteinom iMab in i-motivom. Rezultati so pokazali, da se telomerno zaporedje hTeloC zvije v stabilno i-motivno strukturo v pH območju 5,4–6,0. Fosfatni pufer je omogočil tudi najboljše ločevanje signalov v NMR spektrih. Naši eksperimenti potrjujejo, da je v fosfatnem pufru pri pH vrednostih od 5,4 do 6,0 iMab nativno zvit in pretežno monomeren. iMab prepoznava tridimenzionalno strukturo DNA zaporedja hTeloC ter z njo interagira odvisno od lokalnega okolja ali sestave raztopine, v kateri se nahaja. Določili smo KD za interakcijo med iMab in i-motivom, ki je v fosfatnemu pufru pri pH 5,4 znašala 47,8 μM. Identificirali smo regije i-motiva, ki sodelujejo v interakciji s proteinom. Za interakcijo so najpomembnejše zanke i-motiva. Največji prispevek k interakciji so imeli ostanki T10, A11 in A12, ki se nahajajo v isti zanki, ter T22, ki se prav tako nahaja prostorsko blizu te zanke.

• Language: Slovenian
• Keywords: i-motiv, iMab, NMR spektroskopija
• Work type: Master's thesis/paper
• Typology: 2.09 - Master's Thesis
• Organization: FKKT - Faculty of Chemistry and Chemical Technology
• Year: 2025
• PID: 20.500.12556/RUL-173299
• COBISS.SI-ID: 257281283
• Publication date in RUL: 15.09.2025

Secondary language

• Language: English
• Title: Interactions of the monoclonal antibody iMab with cytosine-rich DNA nucleotide sequences

Abstract

I-motifs are non-canonical DNA structures that form in cytosine-rich nucleotide sequences. They form under acidic conditions, where protonated cytosine nucleotides generate hemiprotonated C•C⁺ base pairs. Because these folded sequences are highly dynamic and reversible, they could serve as cellular regulators of transcription, replication, and the establishment and maintenance of epigenetic modifications. Immunoprecipitation studies based on the binding of monoclonal antibodies to nuclear DNA have shown that i-motifs can form in vivo. The most commonly used antibody for these types of studies is iMab, which was developed against the i-motif formed by the telomeric sequence hTeloC (CCCTAACCCTAACCCTAACCCT). iMab is a single-chain fragment of a human monoclonal antibody that binds to inter- and intramolecular i-motifs. In addition, iMab does not bind to DNA structures such as double-stranded DNA, DNA hairpins, and mutated telomeric sequences that do not fold into i-motifs. In recent times, doubts have arisen about the specificity of the iMab antibody towards i-motifs in comparison to unfolded cytosine-rich DNA sequences. For this reason, we used spectroscopic methods, including NMR, CD, and DLS spectroscopy, to characterize the functional state of the protein iMab and its interaction with the i-motif. The results showed that the telomeric sequence hTeloC folds into a stable i-motif structure at pH 5.4–6.0 in phosphate buffer. These conditions also provided the best signal resolution in NMR spectra. Our experiments confirm that iMab is in its native conformation in phosphate buffers in the pH range from 5.4 to 6.0. iMab recognises the three-dimensional structure of the hTeloC sequence and interacts with it depending on the local environment or solution composition. We determined the KD for the interaction between iMab and the i-motif to be 47.8 μM. The nucleotides that provide the greatest contributions to the binding were identified as T10, A11 and A12, which belong to the same loop, as well as T22, which is also spatially close to the aforementioned loop.

• Keywords: i-motif, iMab, NMR spectroscopy