NMR študija s purini bogatih tandemskih ponovitev povezanih s kolapsom replikacijskih vilic

Šadl, Alen (author), Plavec, Janez (mentor)

V okviru magistrskega dela smo se osredotočili na s purini bogate oligonukleotide DNA, ki vsebujejo nukleotidna zaporedja 5'-d(CAGAGG)-3'. Tandemske ponovitve tega zaporedja pri replikaciji človeške genomske DNA tvorijo slabo raziskane sekundarne strukture, ki se tekom podvajanja ne morejo razviti in posledično pride do kolapsa replikacijskih vilic. Znotraj človeškega genoma najdemo vsaj trikratno ponovitev omenjenega zaporedja v več kot polovici vseh kromosomov. Nekatera najdemo tudi znotraj zapisov za pomembne proteine, kot so nekateri proteini iz družine metalopeptidaz ADAM, transkripcijski faktorji in drugi. Za preučevanje tvorbe sekundarne strukture smo pripravili daljši oligonukleotid RS4, 5'-d(TTGCAGAGGCAGAGGCAGAGGCAA)-3', ki vsebuje trojno ponovitev preiskovanega zaporedja z modificiranim 5'- in 3'-koncem, ki prispeva k večji termodinamski stabilnosti, ter krajši oligonukleotid SLL1 5'-d(GTGCAGAGGCAC)-3', ki vsebuje le eno ponovitev preiskovanega zaporedja. S pomočjo NMR strukturne študije smo ugotovili, da oligonukleotid RS4 tvori strukturo, ki vsebuje steblo in tri zanke AGAG, ki jih v trenutno obstoječi literaturi še nihče ni okarakteriziral na atomskem nivoju. Dokazali smo, da se oligonukleotid RS4 v prisotnosti kalijevih ionov zvije v simetrično strukturo, s po dvema baznima paroma GC in AT v Watson-Crick geometriji. Pri tem velja omeniti, da je simetričnost strukture skladna z NMR spektroskopskimi parametri, zlasti manjšim številom signalov od pričakovanega. Alternativno lahko omenjeno manjše število signalov od pričakovanega pripišemo tudi konformacijskim spremembam s specifično dinamiko, zaradi katere so spektralni signali neopazni na 1H NMR-časovni skali. Pri analizi krajšega oligonukleotida SLL1 smo ugotovili, da ima koncentracija soli nanj večji vpliv, saj višja koncentracija kalijevih ionov favorizira tvorbo dimerne zvrsti SLL1, medtem ko spremembe v molekularnosti zvitja v primeru RS4 nismo ugotovili. S pomočjo 13C- in 15N-izotopskega označevanja posameznih nukleotidnih ostankov v SLL1 in z uporabo 2D NMR-metod smo asignirati večino 1H NMR-signalov. Nadalje smo analizirali korelacije NOE in izračunali strukturni model monomerne zvrsti, s katerim smo pridobili vpogled visoke ločljivosti v strukturne elemente značilne za DNA odseke s tandemskim zaporedjem 5'-d(CAGAGG)-3'.

• Language: Slovenian
• Keywords: NMR, DNA, zaporedje CAGAGG, zanke AGAG, lasnična zanka
• Work type: Master's thesis/paper
• Typology: 2.09 - Master's Thesis
• Organization: FKKT - Faculty of Chemistry and Chemical Technology
• Year: 2021
• PID: 20.500.12556/RUL-128502
• COBISS.SI-ID: 72158979
• Publication date in RUL: 15.07.2021

Secondary language

• Language: English
• Title: NMR study of purine rich tandem repeats linked to replication fork collapse

Abstract

During this masters study, we focused on purine rich DNA oligonucleotide containing 5’-d(CAGAGG)-3’ repeat(s). Human genome contains segments with tandem repeats of the mentioned sequence that forms poorly known secondary structures, which during DNA replication causes replication fork stalling, resulting in their collapse. Within human genome there are at least three tandem repeats of the sequence in more than half of all chromosomes. Some are even located inside important protein sequences like ADAM metallopeptidase, transcription factors and other. We carried out study of the secondary structures adopted by oligonucleotide RS4, 5’-d(TTGCAGAGaAGAGGCAGAGGCAA)-3’, which contains triple repeat of the 5’-d(CAGAGG)-3’ flanked by modified 5’- and 3’-ends specifically designed to enhance thermodynamic stability. In parallel, we investigate structure adopted by a shorter oligonucleotide SLL1, 5’-d(GTGCAGAGGCAC)-3’, which contains only one 5’-d(CAGAGG)-3’ repeat. With the use of NMR, we have discovered that structures adopted by RS4 exhibit a short stem and three AGAG loops, which in existing literature have not yet been characterized at atomic level. We proved, that oligonucleotide RS4 in the presence of potassium ions folds in a symmetrical structure with two GC and two AT base pairs in Watson-Crick geometry. Furthermore, proposed symmetry of the structure is in agreement with the collected NMR data, especially the lower number of proton signals with respect to expected from the number of residues in the RS4 DNA sequence. Alternatively, missing peaks could also be explained by conformational changes with specific dynamics, which leads to 1H NMR spectral signals being broadened to the baseline - undetectable on 1H NMR time scale. We found that salt concentration has a great effect on the smaller oligonucleotide SLL1, with the higher potassium ion concentrations favouring dimeric structural fold, while such monomer-dimer transition is not observed for RS4. With the use of 13C- and 15N-isotopic labelling of the nucleotide residues in the SLL1 and with use of 2D NMR methods we assigned most of the 1H NMR signals. We further analysed NOE correlations and calculated the structural model of the monomer structure, which depicts structural characteristics of 5’-d(CAGAGG)-3’ tandem repeats.

• Keywords: NMR, DNA, sequence CAGAGG, AGAG loop, hairpin